Saturday, 30 July 2016

Code For finding aProtien string in a DNA --Java Programming: Solving Problems with Software

import edu.duke.*;
import java.io.*;
public class TagFinder{
    public String findProtein(String dna){
        int start = dna.indexOf("atg");
        int stop = dna.indexOf("tag", start +3);
        if (start == -1){
            return "no starton protein found";
        }
      
        if ((stop-start)%3==0){
            return dna.substring(start,stop+3);
        }
        else{
            return"not not a protein because of Divisible factor";
        }
    }
    public void testing()
    {
        String a = "cccatggggtttaaataataataggagagagagagagagttt";
        String ap = "atggggtttaaataataatag";
        //String a = "sdafsdfsdatgccctagdsfsdfgsffd";
        //String ap = "atgccctag";
        //String a = "atgcctag";
        //String ap = "";
        //String a = "ATGCCCTAG";
        //String ap = "ATGCCCTAG";
        String result = findProtein(a);
        if (ap.equals(result)){
            System.out.println("sucess for "+ap + "length " + ap.length());
        }
        else{
            System.out.println("mistake for input:"+a);
            System.out.println("got:"+result);
            System.out.println("not:"+ap);
        }
    }
    public void realTesting(){
      DirectoryResource dr = new DirectoryResource();
      for (File f : dr.selectedFiles()){
        FileResource fr = new FileResource(f);
        String s =fr.asString();
        System.out.println("read "+s.length()+" character");
        String result = findProtein(s);
        System.out.println("found "+ result);
        }
    }
}

No comments:

Post a Comment